Pedido rápido

Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CHIT1 Información de producto de clon de cDNA
Tamaño de cDNA:1401bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens chitinase 1 (chitotriosidase) with N terminal Flag tag.
Sinónimo de gen:CHI3, CHIT, FLJ00314, MGC125322
Sitio de restricción:KpnI + XbaI (6kb + 1.43kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human CHIT1 Gene Plasmid Map
Human Chitotriosidase / Chitinase 1 / CHIT1 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11223-ACG$225
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11223-ACR$225
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11223-CF$195
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11223-CH$195
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11223-CM$195
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11223-CY$195
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(Vector de expresión)HG11223-M$75
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11223-NF$195
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11223-NH$195
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11223-NM$195
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11223-NY$195
Humano Chitotriosidase/Chitinase 1/CHIT1 clonación del ADN o clonación génica(vector de clonación)HG11223-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Chitotriosidase, also known as Chitinase-1 and CHIT1, is a member of the glycosyl hydrolase 18 family and Chitinase class II subfamily. It is a member of the mammalian chitinase family, structurally homologous to chitinases from other species, is synthesized and secreted by specifically activated macrophages. Chitotriosidase is a polymer of N-acetylglucosamine. Serum and plasma chitotriosidase activity is usually measured as the first step in diagnosis of Gaucher disease. Monitoring chitotriosidase activity is widely used during treatment of this pathology by enzyme replacement therapy. Its elevated plasma level reflects gradual intralysosomal accumulation in Gaucher cells (lipid-loaded macrophages). Macrophages overloaded by the enzyme accumulated in lysosomal material (lipids) were shown to secrete chitotriosidase; its increased expression was noted in several lysosomal storage diseases and atherosclerosis. In addition to lipid storage disorders, where Chit activity has longer been used as a marker of disease activity and therapeutic response, elevation of plasma Chit may occur in hematological disorders with storage of erythrocyte membrane breakdown products as thalassemia and different systemic infectious diseases sustained by fungi and other pathogens. Recently, increased Chit activity was demonstrated in CNS from patients with different neurological disorders. Chitotriosidase is believed to play a role in mechanisms of immunity and protection against chitin-containing pathogens.

  • Barone R, et al. (2007) Plasma chitotriosidase in health and pathology. Clin Lab. 53(5-6): 321-33.
  • Bargagli E, et al. (2008) Human chitotriosidase: a potential new marker of sarcoidosis severity. Respiration. 76(2): 234-8.
  • Korolenko TA, et al. (2010) Chitotriosidase of human macrophages and mammalian chitinases: biological functions and abnormalities in pathology. Vestn Ross Akad Med Nauk. (11): 39-45.
  • Size / Price
    Catálogo: HG11223-NF
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human Chitotriosidase / Chitinase 1 / CHIT1 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.