Pedido rápido

Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano CSTA Información de producto de clon de cDNA
    Tamaño de cDNA:297bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens cystatin A (stefin A) with C terminal HA tag.
    Sinónimo de gen:STF1, STFA, CSTA
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    ( We provide with CSTA qPCR primers for gene expression analysis, HP100501 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10479-ACG$225
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10479-ACR$225
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10479-ANG$225
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10479-ANR$225
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10479-CF$195
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10479-CH$195
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10479-CM$195
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10479-CY$195
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(Vector de expresión)HG10479-M$75
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10479-NF$195
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10479-NH$195
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10479-NM$195
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10479-NY$195
    Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación)HG10479-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name

    Cystatin-A, also known as Cystatin-AS, Stefin-A and CSTA, is a cytoplasm protein which belongs to the cystatin family. Cystatin-A / CSTA is a cysteine proteinase inhibitor with a molecular mass of 11 kDa, and is located mainly in the keratohyaline granules of the stratum granulosum and the cornified envelope of the stratum corneum in the epidermis. The cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. Cystatins are physiological inhibitors of cysteine proteinases which are widely distributed in human tissues and fluids. Cystatins typically comprise about 115 amino acids, are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds. Cystatins may be glycosylated and / or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired inhibitory activity. Cystatins mainly inhibit peptidases belonging to peptidase families C1 (papain family) and C13 (legumain family).

    Size / Price
    Catálogo: HG10479-CY
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.