Pedido rápido

Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human CSTA Información de producto de clon de cDNA
Tamaño de cDNA:297bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens cystatin A (stefin A) with C terminal HA tag.
Sinónimo de gen:STF1, STFA, CSTA
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10479-ACG$225
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10479-ACR$225
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10479-ANG$225
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10479-ANR$225
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10479-CF$195
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10479-CH$195
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10479-CM$195
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10479-CY$195
Humano Cystatin A / CSTA clonación del ADN o clonación génica(Vector de expresión)HG10479-M$75
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10479-NF$195
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10479-NH$195
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10479-NM$195
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10479-NY$195
Humano Cystatin A / CSTA clonación del ADN o clonación génica(vector de clonación)HG10479-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Cystatin-A, also known as Cystatin-AS, Stefin-A and CSTA, is a cytoplasm protein which belongs to the cystatin family. Cystatin-A / CSTA is a cysteine proteinase inhibitor with a molecular mass of 11 kDa, and is located mainly in the keratohyaline granules of the stratum granulosum and the cornified envelope of the stratum corneum in the epidermis. The cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. Cystatins are physiological inhibitors of cysteine proteinases which are widely distributed in human tissues and fluids. Cystatins typically comprise about 115 amino acids, are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds. Cystatins may be glycosylated and / or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired inhibitory activity. Cystatins mainly inhibit peptidases belonging to peptidase families C1 (papain family) and C13 (legumain family).

Size / Price
Catálogo: HG10479-CY
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.