CST6 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

CST6 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
450 bp
Description
Full length Clone DNA of Human cystatin E/M with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CST6 Background Information

Cystatin E/M, also referred to as CST6, is a member of type 2 cysteine proteinase inhibitors of the cystatin superfamily, and inhibits papain and cathepsin B. Cystatin E is a low molecular mass secreted protein existing in both a glycosylated (17 kDa) and an unglycosylated (14 kDa) form, with two characteristic intrachain disulfide bridges. Expression of cystatin M/E is found to be restricted to the epidermis, more specifically in the stratum granulosum, sweat glands, sebaceous glands, and the hair follicles. In addition to its function as a cysteine protease inhibitor, cystatin M/E also serves as a target for cross-linking by transglutaminases. Accordingly, cystatin M/E was suggested to be involved in barrier formation and maintenance. Furthermore, studies have revealed that cystatin M/E is frequently epigenetically inactivated during breast carcinogenesis, and thus be regarded as a candidate of tumour suppressor gene.
Full Name
cystatin E/M
References
  • Ritonja A., et al.,(1985), Amino acid sequence of the intracellular cysteine proteinase inhibitor cystatin B from human liver. Biochem. Biophys. Res. Commun. 131:1187-1192.
  • Pennacchio L.A., et al., (1996), Mutations in the gene encoding cystatin B in progressive myoclonus epilepsy (EPM1).Science 271:1731-1734.
  • Ghaemmaghami S., et al.,(2003), Global analysis of protein expression in yeast.Nature 425:737-741.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait