Pedido rápido

Text Size:AAA

Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human DBH Información de producto de clon de cDNA
Tamaño de cDNA:1812bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens dopamine beta-hydroxylase (dopamine beta-monooxyge) with N terminal HA tag.
Sinónimo de gen:DBM, DBH
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13440-ACG$245
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13440-ACR$245
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG13440-ANG$245
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG13440-ANR$245
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13440-CF$215
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13440-CH$215
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13440-CM$215
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13440-CY$215
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(Vector de expresión)HG13440-G$75
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13440-NF$215
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13440-NH$215
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13440-NM$215
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13440-NY$215
Humano DBH / Dopamine beta-Hydroxylase clonación del ADN o clonación génica(vector de clonación)HG13440-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

DBH is a 290 kDa copper-containing oxygenase. It can be detected in noradrenergic nerve terminals of the central and peripheral nervous systems, and is also expressed in chromaffin cells of the adrenal medulla. DBH contains our identical subunits, and its activity requires ascorbate as a cofactor. It functions in in the synthesis of small-molecule neurotransmitters that is membrane-bound, making norepinephrine the only transmitter synthesized inside vesicles. DBH has been shown to be associated with decision making and addictive behaviors such as alcohol and smoking, attention deficit hyperactivity disorder, and also with neurological diseases such as Schizophrenia and Alzheimer's.

  • Rush RA. et al., 1980, Crit Rev Clin Lab Sci. 12 (3): 241-77.
  • Goldstein M. et al., 1964, Life Sci. 3 (7): 763-7.
  • S Friedman. et al., 1966, The Journal of Biological Chemistry. 241 (10): 2256-9.
  • Size / Price
    Catálogo: HG13440-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.