After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human DCTPP1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC001344
Tamaño de cDNA:513bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens dCTP pyrophosphatase 1 with N terminal Flag tag.
Sinónimo de gen:CDA03, RS21C6, XTP3TPA
Especie:Human
Vector:pCMV3-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14577-ACG$225
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14577-ACR$225
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14577-ANG$225
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14577-ANR$225
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14577-CF$195
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14577-CH$195
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14577-CM$195
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14577-CY$195
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(Vector de expresión)HG14577-G$75
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14577-NF$195
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14577-NH$195
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14577-NM$195
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14577-NY$195
Humano XTP3TPA / DCTPP1 clonación del ADN o clonación génica(vector de clonación)HG14577-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

DCTPP1 hydrolyzes deoxynucleoside triphosphates (dNTPs) to the corresponding nucleoside monophosphates. It has a strong preference for modified dCTP. DCTPP1’s activity is highest with 5-iodo-dCTP, followed by 5-bromo-dCTP, unmodified dCTP, 5-methyl-dCTP and 5-chloro-dCTP. DCTPP1 also hydrolyzes 2-chloro-dATP and 2-hydroxy-dATP with lower efficiency, and has even lower activity with unmodified dATP, dTTP and dUTP (in vitro). DCTPP1 does not hydrolyze ATP, UTP, ITP, GTP, dADP, dCDP or dGTP. It may protect DNA or RNA against the incorporation of non-canonical nucleotide triphosphates. DCTPP1 may also protect cells against inappropriate methylation of CpG islands by DNA methyltransferases.

Referencias
  • Stelzl U. et al., 2005, Cell. 122 (6): 957-68.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Moroz OV. et al., 2005, J Mol Biol. 347 (2): 243-55.
  • Size / Price
    Catálogo: HG14577-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"