Pedido rápido

Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human DDC Información de producto de clon de cDNA
Tamaño de cDNA:1443bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens dopa decarboxylase (aromatic L-amino acid decarboxylase) with N terminal Flag tag.
Sinónimo de gen:AADC
Sitio de restricción:HindIII + XbaI (6kb + 1.48kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human DDC Gene Plasmid Map
Human DDC natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10560-ACG$225
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10560-ACR$225
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10560-ANG$225
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10560-ANR$225
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10560-CF$195
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10560-CH$195
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10560-CM$195
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10560-CY$195
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(Vector de expresión)HG10560-M$75
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación)HG10560-M-N$195
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10560-NF$195
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10560-NH$195
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10560-NM$195
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10560-NY$195
Humano DOPA Decarboxylase/DDC clonación del ADN o clonación génica(vector de clonación)HG10560-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.
  • Size / Price
    Catálogo: HG10560-NF
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human DDC natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.