DHTKD1 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

DHTKD1 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2760 bp
Description
Full length Clone DNA of Human dehydrogenase E1 and transketolase domain containing 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DHTKD1 cDNA ORF Clone, Human, C-His tag: Alternative Names

AMOXAD cDNA ORF Clone, Human; CMT2Q cDNA ORF Clone, Human

DHTKD1 Background Information

DHTKD1, a part of 2-ketoadipic acid dehydrogenase complex, is involved in lysine and tryptophan catabolism. Mutations in DHTKD1 block the metabolic pathway and cause 2-aminoadipic and 2-oxoadipic aciduria (AMOXAD), an autosomal recessive inborn metabolic disorder. The mutations in dehydrogenase E1 and transketolase domain-containing 1 (DHTKD1), a mitochondrial protein encoding gene, could cause neurological abnormalities
Full Name
dehydrogenase E1 and transketolase domain containing 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait