After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human DIRAS3 Información de producto de clon de cDNA
Gene_bank_ref_id:BC005362
Tamaño de cDNA:690bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens DIRAS family, GTP-binding RAS-like 3.
Sinónimo de gen:ARHI, NOEY2, DIRAS3
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14239-ACG$225
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14239-ACR$225
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14239-ANG$225
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14239-ANR$225
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14239-CF$195
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14239-CH$195
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14239-CM$195
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14239-CY$195
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(Vector de expresión)HG14239-G$75
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14239-NF$195
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14239-NH$195
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14239-NM$195
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14239-NY$195
Humano ARHI / DIRAS3 clonación del ADN o clonación génica(vector de clonación)HG14239-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

ARHI, also known as DIRAS3, belongs to the small GTPase superfamily, Di-Ras family. ARHI gene is a novel tumor suppressor gene located on chromosome 1p31. Downregulation of ARHI expression has been detected in many types of cancer. ARHI is expressed in normal ovarian and breast epithelial cells but not in ovarian and breast cancers. As a suppressor, ARHI is not only an important factor in the pathogenesis of gastric cancer, but also a potential factor for tumor aggravation. ARHI expression in gastric cancer can be employed to indicate favorable prognosis for the disease.

Referencias
  • Pei XH. et al., 2011, Cell Biol Int. 35 (10): 1019-24.
  • Lin D. et al., 2011, J Int Med Res. 39 (5): 1870-5.
  • Wang W. et al., 2012, Oncol Rep. 27 (6): 1953-9.
  • Size / Price
    Catálogo: HG14239-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"