Pedido rápido

Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human DLL4 Información de producto de clon de cDNA
Tamaño de cDNA:2058bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens delta-like 4 (Drosophila) with N terminal Myc tag.
Sinónimo de gen:DLL4, hdelta2, MGC126344
Sitio de restricción:KpnI(two restriction sites) + XbaI (6kb + 1.72kb + 0.35kb)
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human DLL4 Gene Plasmid Map
Human DLL4 ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10171-ACG$245
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10171-ACR$245
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10171-CF$215
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10171-CH$215
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10171-CM$215
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10171-CY$215
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(Vector de expresión)HG10171-M$75
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación)HG10171-M-N$215
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10171-NF$215
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10171-NH$215
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10171-NM$215
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10171-NY$215
Humano DLL4/Delta-like 4 clonación del ADN o clonación génica(vector de clonación)HG10171-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Delta-like protein 4 (DLL4, Delta4), a type I membrane-bound Notch ligand, is one of five known Notch ligands in mammals and interacts predominantly with Notch 1, which has a key role in vascular development. Recent studies yield substantial insights into the role of DLL4 in angiogenesis. DLL4 is induced by vascular endothelial growth factor (VEGF) and acts downstream of VEGF as a 'brake' on VEGF-induced vessel growth, forming an autoregulatory negative feedback loop inactivating VEGF. DLL4 is downstream of VEGF signaling and its activation triggers a negative feedback that restrains the effects of VEGF. Attenuation of DLL4/Notch signaling results in chaotic vascular network with excessive branching and sprouting. DLL4 is widely distributed in tissues other than vessels including many malignancies. Furthermore, the molecule is internalized on binding its receptor and often transported to the nucleus. In pathological conditions, such as cancer, DLL4 is up-regulated strongly in the tumour vasculature. Blockade of DLL4-mediated Notch signaling strikingly increases nonproductive angiogenesis, but significantly inhibits tumor growth in preclinical mouse models. In preclinical studies, blocking of DLL4/Notch signaling is associated with a paradoxical increase in tumor vessel density, yet causes marked growth inhibition due to functionally defective vasculature. Thus, DLL4 blockade holds promise as an additional strategy for angiogenesis-based cancer therapy.

  • Yan M, et al. (2007) Delta-like 4/Notch signaling and its therapeutic implications. Clin Cancer Res. 13(24): 7243-6.
  • Sainson RC, et al. (2007) Anti-Dll4 therapy: can we block tumour growth by increasing angiogenesis? Trends Mol Med. 13(9): 389-95.
  • Martinez JC, et al. (2009) Nuclear and membrane expression of the angiogenesis regulator delta-like ligand 4 (DLL4) in normal and malignant human tissues. Histopathology. 54(5): 598-606.
  • Li JL, et al. (2010) Targeting DLL4 in tumors shows preclinical activity but potentially significant toxicity. Future Oncol. 6(7): 1099-103.
  • Size / Price
    Catálogo: HG10171-NM
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human DLL4 ORF mammalian expression plasmid, N-Myc tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.