Pedido rápido

Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human DPEP1 Información de producto de clon de cDNA
Tamaño de cDNA:1236bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens dipeptidase 1 (renal) with C terminal Myc tag.
Sinónimo de gen:MDP, RDP, MBD1, DPEP1
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13543-ACG$225
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13543-ACR$225
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13543-CF$195
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13543-CH$195
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13543-CM$195
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13543-CY$195
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(Vector de expresión)HG13543-G$75
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13543-NF$195
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13543-NH$195
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13543-NM$195
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13543-NY$195
Humano dehydropeptidase-I / DPEP1 clonación del ADN o clonación génica(vector de clonación)HG13543-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Dehydropeptidase-I, also known as DPEP1, is a kidney membrane enzyme. Its expression in normal colonic mucosa is very low, but it is highly expressed in colorectal adenoma and cancer specimens and is negatively correlated with parameters of pathological aggressiveness and poor prognosis. The overexpression of DPEP1 suppressed tumor cells invasiveness and increased sensitivity to chemotherapeutic agent Gemcitabine. Growth factor EGF treatment decreased DPEP1 expression. Dehydropeptidase-I may be a candidate target in PDAC for designing improved treatments. It uses zinc as a cofactor and acts as a disulfide-linked homodimer.

  • Toiyama Y. et al., 2011, J Gastroenterol. 46 (2): 153-63.
  • Zhang G. et al., 2012, PLoS One. 7 (2): e31507.
  • Okamoto T. et al., 2011, Mod Pathol. 24 (2): 267-76.
  • Size / Price
    Catálogo: HG13543-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.