Pedido rápido

Humano DPP7 / DPPII / DPP2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human DPP7 Información de producto de clon de cDNA
Tamaño de cDNA:1479bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens dipeptidyl-peptidase 7 with N terminal His tag.
Sinónimo de gen:QPP, DPP2, DPPII, DPP7
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano DPP7 / DPPII / DPP2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Product nameProduct name

DPP7 (dipeptidylpeptidase 7), also known as DPPII and DPP2, is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. Dipeptidyl peptidases (DPPs) have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. DPPs mediate regulatory activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. DPPs can bind specific voltage-gated potassium channels and alter their expression and biophysical properties and may also influence T cells. DPP proteins include DPRP1, DPRP2, DPP3, DPP7, DPP10, DPPX and CD26. It localizes to lysosomes. DPP7 localizes to lysosomes and exists as a homodimer via its leucine zipper motif and is involved in the degradation of oligopeptides. In response to calcium release, it can be secreted in its active form. It is essential for lymphocyte survival, as the inhibition of DPP7 results in quiescent cell apoptosis.

  • Chiravuri M, et al. (1999) A novel apoptotic pathway in quiescent lymphocytes identified by inhibition of a post-proline cleaving aminodipeptidase: a candidate target protease, quiescent cell proline dipeptidase. J Immunol. 163(6):3092-9.
  • Fukasawa KM, et al. (2001) Cloning and functional expression of rat kidney dipeptidyl peptidase II. Biochem J. 353(Pt 2):283-90.
  • Fornas E, et al. (1992) Effect of cholesterol and its autooxidation derivatives on endocytosis and dipeptidyl peptidases of aortic endothelial cells. Histol Histopathol. 7(2):163-8.
  • Size / Price
    Catálogo: HG10748-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.