Pedido rápido

Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano DPYS Información de producto de clon de cDNA
Tamaño de cDNA:1561bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens dihydropyrimidinase with N terminal Myc tag.
Sinónimo de gen:DHP, DHPase
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
( We provide with DPYS qPCR primers for gene expression analysis, HP103514 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14884-ACG$245
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14884-ACR$245
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14884-ANG$245
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14884-ANR$245
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14884-CF$215
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14884-CH$215
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14884-CM$215
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14884-CY$215
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(Vector de expresión)HG14884-G$75
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14884-NF$215
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14884-NH$215
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14884-NM$215
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14884-NY$215
Humano DPYS / Dihydropyrimidinase clonación del ADN o clonación génica(vector de clonación)HG14884-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second step of the reductive pyrimidine degradation, the reversible hydrolytic ring opening of dihydropyrimidines. It can catalyzes the ring opening of 5,6-dihydrouracil to N-carbamyl-alanine and of 5,6-dihydrothymine to N-carbamyl-amino isobutyrate. DPYS is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria.

  • Thomas HR. et al., 2008, Genomics. 18 (1): 25-35.
  • Thomas HR. et al., 2008, Pharmacogenet Genomics. 17 (11): 973-87.
  • Van Kuilenburg AB. et al., 2007, Mol Genet Metab. 91 (2): 157-64.
  • Size / Price
    Catálogo: HG14884-NM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.