DPYS cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

DPYS cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1561 bp
Description
Full length Clone DNA of Human dihydropyrimidinase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DPYS cDNA ORF Clone, Human, N-Myc tag: Alternative Names

DHP cDNA ORF Clone, Human; DHPase cDNA ORF Clone, Human

DPYS Background Information

DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second step of the reductive pyrimidine degradation, the reversible hydrolytic ring opening of dihydropyrimidines. It can catalyzes the ring opening of 5,6-dihydrouracil to N-carbamyl-alanine and of 5,6-dihydrothymine to N-carbamyl-amino isobutyrate. DPYS is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria.
Full Name
dihydropyrimidinase
References
  • Thomas HR. et al., 2008, Genomics. 18 (1): 25-35.
  • Thomas HR. et al., 2008, Pharmacogenet Genomics. 17 (11): 973-87.
  • Van Kuilenburg AB. et al., 2007, Mol Genet Metab. 91 (2): 157-64.
Add to Cart Successfully Add to Cart Failed