After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Humano RCAS1 / EBAG9 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human EBAG9 Información de producto de clon de cDNA
Gene_bank_ref_id:BC017729
Tamaño de cDNA:642bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens estrogen receptor binding site associated, antigen, 9 with C terminal His tag.
Sinónimo de gen:EB9, PDAF, RCAS1, EBAG9
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fondo

RCAS1, also known as EBAG9, is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. RCAS1 gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor which binds to the estrogen-responsive element (ERE) found in the 5'-flanking region of RCAS1 gene. Two transcript variants differing in the 5' UTR, but encoding the same protein, have been identified for RCAS1 gene. EBAG9 may participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.

Referencias
  • Ohshima K. et al., 2001, Clin Exp Immunol. 123 (3): 481-6.
  • Ikeda K. et al., 2000, Biochem Biophys Res Commun. 273 (2): 654-60.
  • Nakashima M. et al., 1999, Nat Med. 5 (8): 938-42.
  • Size / Price
    Catálogo: HG14012-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"