Pedido rápido

Humano EDIL3 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

  • Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
Hoja de datosReseñasProductos relacionadosProtocolos
Humano EDIL3 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_005711.3
Tamaño de cDNA:1467 bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens EGF-like repeats and discoidin I-like domains 3 with N terminal His tag.
Sinónimo de gen:DEL1, EDIL3
Especie:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-EDIL3
Sitio de restricción:KpnI + XbaI(6kb+1.47kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with EDIL3 qPCR primers for gene expression analysis, HP102367 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catálogo: HG13688-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"