Pedido rápido

Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano EEF1B2 Información de producto de clon de cDNA
    Tamaño de cDNA:678bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation elongation factor 1 beta 2 with C terminal HA tag.
    Sinónimo de gen:EF1B, EEF1B, EEF1B1
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    ( We provide with EEF1B2 qPCR primers for gene expression analysis, HP103245 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14611-ACG$225
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14611-ACR$225
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14611-ANG$225
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14611-ANR$225
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14611-CF$195
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14611-CH$195
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14611-CM$195
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14611-CY$195
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(Vector de expresión)HG14611-G$75
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14611-NF$195
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14611-NH$195
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14611-NM$195
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14611-NY$195
    Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación)HG14611-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name

    EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • Size / Price
    Catálogo: HG14611-CY
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.