Pedido rápido

Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano EEF1B2 Información de producto de clon de cDNA
Tamaño de cDNA:678bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation elongation factor 1 beta 2 with C terminal His tag.
Sinónimo de gen:EF1B, EEF1B, EEF1B1
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
( We provide with EEF1B2 qPCR primers for gene expression analysis, HP103245 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14611-ACG$225
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14611-ACR$225
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14611-ANG$225
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14611-ANR$225
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14611-CF$195
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14611-CH$195
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14611-CM$195
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14611-CY$195
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(Vector de expresión)HG14611-G$75
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14611-NF$195
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14611-NH$195
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14611-NM$195
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14611-NY$195
Humano EF1B / EEF1B2 clonación del ADN o clonación génica(vector de clonación)HG14611-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • Size / Price
    Catálogo: HG14611-CH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.