EFEMP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11172-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All EFEMP2 Reagents

CRO Services

Product recommended


All EFEMP2 Reagents

EFEMP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1332 bp
Description
Full length Clone DNA of Human EGF-containing fibulin-like extracellular matrix protein 2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EFEMP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

ARCL1B cDNA ORF Clone, Human;FBLN4 cDNA ORF Clone, Human;MBP1 cDNA ORF Clone, Human;UPH1 cDNA ORF Clone, Human

EFEMP2 Background Information

Full Name
EGF containing fibulin-like extracellular matrix protein 2

EFEMP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EFEMP2 cDNA ORF Clone in Cloning Vector, Mouse MG52071-G
EFEMP2 cDNA ORF Clone, Mouse, untagged MG52071-UT
EFEMP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52071-ACGLN
EFEMP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52071-ACG
EFEMP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52071-ACR
EFEMP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52071-CF
EFEMP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52071-NF
EFEMP2 cDNA ORF Clone, Mouse, C-His tag MG52071-CH
EFEMP2 cDNA ORF Clone, Mouse, N-His tag MG52071-NH
EFEMP2 cDNA ORF Clone, Mouse, C-HA tag MG52071-CY
EFEMP2 cDNA ORF Clone, Mouse, N-HA tag MG52071-NY
EFEMP2 cDNA ORF Clone, Mouse, C-Myc tag MG52071-CM
EFEMP2 cDNA ORF Clone, Mouse, N-Myc tag MG52071-NM
EFEMP2 qPCR Primer Pairs, Mouse MP201944

EFEMP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EFEMP2 cDNA ORF Clone in Cloning Vector, Human HG11172-M
EFEMP2 cDNA ORF Clone, Human, untagged HG11172-UT
EFEMP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11172-ACG
EFEMP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11172-ACGLN
EFEMP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11172-ACR
EFEMP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11172-NF
EFEMP2 cDNA ORF Clone, Human, C-His tag HG11172-CH
EFEMP2 cDNA ORF Clone, Human, N-His tag HG11172-NH
EFEMP2 cDNA ORF Clone, Human, C-HA tag HG11172-CY
EFEMP2 cDNA ORF Clone, Human, N-HA tag HG11172-NY
EFEMP2 cDNA ORF Clone, Human, C-Myc tag HG11172-CM
EFEMP2 cDNA ORF Clone, Human, N-Myc tag HG11172-NM
EFEMP2 qPCR Primer Pairs, Human HP101078
info info
添加购物车成功! 添加购物车失败!