After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human EIF2AK1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_014413.3
Tamaño de cDNA:1893bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2-alpha kinase 1.
Sinónimo de gen:HCR, HRI, KIAA1369, EIF2AK1
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10663-ACG$245
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10663-ACR$245
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10663-ANG$245
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10663-ANR$245
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10663-CF$215
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10663-CH$215
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10663-CM$215
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10663-CY$215
Humano eIF2AK1/HRI clonación del ADN o clonación génica(Vector de expresión)HG10663-M$75
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10663-M-F$215
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10663-NF$215
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10663-NH$215
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10663-NM$215
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10663-NY$215
Humano eIF2AK1/HRI clonación del ADN o clonación génica(vector de clonación)HG10663-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10663-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"