Pedido rápido

Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Humano EIF5 Información de producto de clon de cDNA
Tamaño de cDNA:1296bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 5 with C terminal Flag tag.
Sinónimo de gen:EIF-5, EIF-5A
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
( We provide with EIF5 qPCR primers for gene expression analysis, HP102589 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13932-ACG$225
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13932-ACR$225
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG13932-ANG$225
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG13932-ANR$225
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13932-CF$195
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13932-CH$195
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13932-CM$195
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13932-CY$195
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(Vector de expresión)HG13932-G$75
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13932-NF$195
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13932-NH$195
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13932-NM$195
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13932-NY$195
Humano EIF-5A/EIF5 clonación del ADN o clonación génica(vector de clonación)HG13932-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the eukaryotic translation initiation factor (eIF) 2•GTP•tRNA ternary complex within the ribosome-bound pre-initiation complex. In protein synthesis initiation, eIF2 functions in its GTP-bound state to deliver initiator methionyl-tRNA to the small ribosomal subunit and is necessary for protein synthesis in all cells. EIF-5A stabilizes the binding of GDP to eIF2 and is therefore a bi-functional protein that acts as a GDP dissociation inhibitor (GDI). EIF-5A also interacts with eIF1 and eIF3 and binds the eIF2-GTP/Met-tRNA ternary complex along with the 40S ribosome subunit.

  • Si K, et al. (1996) Charactatierizon of multiple mRNAs that encode mammalian translation initiation factor 5 (eIF-5). J Biol Chem. 71(28):16934.
  • Das S, et al. (1998) Specific interaction of eukaryotic translation initiation factor 5 (eIF5) with the beta-subunit of eIF2. J Biol Chem. 272(50):31712-8.
  • Conte MR, et al. (2006) Structure of the eukaryotic initiation factor (eIF) 5 reveals a fold common to several translation factors. Biochemistry. 45(14):4550-8.
  • Size / Price
    Catálogo: HG13932-CF
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.