EIF5 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

EIF5 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1296 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 5.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EIF5 cDNA ORF Clone, Human, untagged: Alternative Names

EIF-5 cDNA ORF Clone, Human; EIF-5A cDNA ORF Clone, Human

EIF5 Background Information

EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the eukaryotic translation initiation factor (eIF) 2•GTP•tRNA ternary complex within the ribosome-bound pre-initiation complex. In protein synthesis initiation, eIF2 functions in its GTP-bound state to deliver initiator methionyl-tRNA to the small ribosomal subunit and is necessary for protein synthesis in all cells. EIF-5A stabilizes the binding of GDP to eIF2 and is therefore a bi-functional protein that acts as a GDP dissociation inhibitor (GDI). EIF-5A also interacts with eIF1 and eIF3 and binds the eIF2-GTP/Met-tRNA ternary complex along with the 4S ribosome subunit.
Full Name
eukaryotic translation initiation factor 5
References
  • Si K, et al. (1996) Charactatierizon of multiple mRNAs that encode mammalian translation initiation factor 5 (eIF-5). J Biol Chem. 71(28):16934.
  • Das S, et al. (1998) Specific interaction of eukaryotic translation initiation factor 5 (eIF5) with the beta-subunit of eIF2. J Biol Chem. 272(50):31712-8.
  • Conte MR, et al. (2006) Structure of the eukaryotic initiation factor (eIF) 5 reveals a fold common to several translation factors. Biochemistry. 45(14):4550-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait