NSE / ENO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

NSE / ENO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1305 bp
Description
Full length Clone DNA of Human enolase 2 (gamma, neuronal) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NSE / ENO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

HEL-S-279 cDNA ORF Clone, Human; NSE cDNA ORF Clone, Human

NSE / ENO2 Background Information

The combination of silencing ENO2 and 2-deoxyglucose (2-DG) synergistically inhibited leukemia cell survival. ENO2 may be a biological marker for monitoring chemotherapeutic efficacy and relapse in ALL. Reduced ENO2 expression may be a biomarker for a subset of autistic children. Neuron specific enolase (ENO2, gamma-enolase) has been used as a biomarker to help identify neuroendocrine differentiation in breast cancer.
Full Name
enolase 2 (gamma, neuronal)
References
  • Pechumer H, et al. (1994) Detection of neuron-specific gamma-enolase messenger ribonucleic acid in normal human leukocytes by polymerase chain reaction amplification with nested primers. Lab Invest. 69 (6): 743-9.
  • Craig SP, et al. (1991) Localisation of neurone-specific enolase (ENO2) to 12p13. Cytogenet Cell Genet. 54 (1-2): 71-3.
  • Muley T, et al. (2003) Technical performance and diagnostic utility of the new Elecsys neuron-specific enolase enzyme immunoassay. Clin Chem Lab Med. 41 (1): 95-103.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait