Pedido rápido

Text Size:AAA

Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ENO3 Información de producto de clon de cDNA
Tamaño de cDNA:1305bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens enolase 3 (beta, muscle) with N terminal His tag.
Sinónimo de gen:GSD13, MSE, ENO3
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14270-ACG$225
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14270-ACR$225
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14270-ANG$225
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14270-ANR$225
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14270-CF$195
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14270-CH$195
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14270-CM$195
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14270-CY$195
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(Vector de expresión)HG14270-G$75
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14270-NF$195
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14270-NH$195
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14270-NM$195
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14270-NY$195
Humano ENO3 / beta-enolase clonación del ADN o clonación génica(vector de clonación)HG14270-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

ENO3 is one of the three enolase isoenzymes found in mammals. As a homodimer, ENO3 is found in skeletal muscle cells in the adult. A switch from alpha enolase to beta enolase occurs in muscle tissue during development in rodents. Mutations in ENO3 gene can be associated with metabolic myopathies that may result from decreased stability of the enzyme. Two transcripts have been identified for ENO3 gene that differ only in their 5' UTR. ENO3 may play a role in muscle development and regeneration. It appears to have a function in striated muscle development and regeneration.

  • Peshavaria M, et al. (1989) Structure of human muscle (beta) enolase mRNA and protein deduced from a genomic clone. Nucleic Acids Res. 17(21):8862.
  • Calì L, et al. (1990) Nucleotide sequence of a cDNA encoding the human muscle-specific enolase (MSE). Nucleic Acids Res. 18(7):1893.
  • Peshavaria M, et al. (1991) Molecular structure of the human muscle-specific enolase gene (ENO3). Biochem J. 275(2):427-33.
  • Size / Price
    Catálogo: HG14270-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.