Pedido rápido

Humano EPDR1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano EPDR1 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC018299
    Tamaño de cDNA:675bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens ependymin related protein 1 (zebrafish) with N terminal His tag.
    Sinónimo de gen:EPDR, UCC1, MERP1, MERP-1, EPDR1
    Especie:Human
    Vector:pCMV3-SP-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EPDR1 qPCR primers for gene expression analysis, HP102345 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Fondo

    EPDR1 is a member of the ependymin family. EPDR1 is a type II transmembrane protein that is similar to two families of cell adhesion molecules, the protocadherins and ependymins. It may play a role in calcium-dependent cell adhesion. EPDR1 is glycosylated, and the orthologous mouse protein is localized to the lysosome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8.

    Referencias
  • Suga T. et al., 2008, Int J Radiat Oncol Biol Phys. 72 (3): 808-13.
  • Rose JE. et al., 2010, Mol Med. 16 (7-8): 247-53.
  • Cheng W. et al., 2010, J Huazhong Univ Sci Technolog Med Sci. 30 (3): 391-6.
  • Size / Price
    Catálogo: HG13665-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"