After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human EPOR Información de producto de clon de cDNA
Gene_bank_ref_id:NR_033663.1
Tamaño de cDNA:1008bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens erythropoietin receptor, transcript variant 2 with C terminal Flag tag.
Sinónimo de gen:EPO-R, MGC138358, EPOR
Especie:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-EPOR-Flag
Sitio de restricción:KpnI + XbaI (6kb + 1.06kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human EPOR Gene Plasmid Map
Human EPOR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human EPOR Gene Expression validated Image
Human EPOR transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
[Hacer clic para ampliar la imagen]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13305-ACG$225
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13305-ACR$225
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13305-CF$195
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13305-CH$195
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13305-CM$195
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13305-CY$195
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)HG13305-G$75
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13305-NF$195
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13305-NH$195
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13305-NM$195
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13305-NY$195
Humano EPOR/Erythropoietin Receptor transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG13305-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Erythropoietin (EPO) is the major glycoprotein hormone regulator of mammalian erythropoiesis, and is produced by kidney and liver in an oxygen-dependent manner. The biological effects of EPO are mediated by the specific erythropoietin receptor (EPOR/EPO Receptor) on bone marrow erythroblasts, which transmits signals important for both proliferation and differentiation along the erythroid lineage. EPOR protein is a type â…  single-transmembrane cytokine receptor, and belongs to the homodimerizing subclass which functions as ligand-induced or ligand-stabilized homodimers. EPOR signaling prevents neuronal death and ischemic injury. Recent studies have shown that EPO and EPOR protein may be involved in carcinogenesis, angiogenesis, and invasion.

Referencias
  • Divoky V, et al. (2002) Mouse surviving solely on human erythropoietin receptor (EpoR): model of human EpoR-linked disease. Blood 99(10): 3873-4.
  • Carruthers SG. (2009) A truncated erythropoietin receptor EPOR-T is associated with hypertension susceptibility. Clin Pharmacol Ther. 86(2): 134-6.
  • Baltaziak M, et al. (2009) Relationships of P53 and Bak with EPO and EPOR in human colorectal cancer. Anticancer Res. 29(10):4151-6.
  • Size / Price
    Catálogo: HG13305-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human EPOR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    • Human EPOR transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"