After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human EQTN Información de producto de clon de cDNA
Gene_bank_ref_id:BC014307
Tamaño de cDNA:384bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens chromosome 9 open reading frame 11.
Sinónimo de gen:AFAF, equatorin, C9orf11
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13292-ACG$225
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13292-ACR$225
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG13292-ANG$225
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG13292-ANR$225
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13292-CF$195
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13292-CH$195
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13292-CM$195
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13292-CY$195
Humano C9ORF11 clonación del ADN o clonación génica(Vector de expresión)HG13292-G$75
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13292-NF$195
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13292-NH$195
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13292-NM$195
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13292-NY$195
Humano C9ORF11 clonación del ADN o clonación génica(vector de clonación)HG13292-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG13292-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"