Pedido rápido

Text Size:AAA

Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ESD Información de producto de clon de cDNA
Tamaño de cDNA:849bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens esterase D with N terminal His tag.
Sinónimo de gen:RP11-147L20.1, FGH, FLJ11763, ESD
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14252-ACG$225
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14252-ACR$225
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14252-ANG$225
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14252-ANR$225
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14252-CF$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14252-CH$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14252-CM$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14252-CY$195
Humano Esterase D/ESD clonación del ADN o clonación génica(Vector de expresión)HG14252-G$75
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14252-NF$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14252-NH$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14252-NM$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14252-NY$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación)HG14252-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase D is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. Esterase D gene is used as a genetic marker and a diagnostic tool for retinoblastoma, Wilson's disease and other hereditary or acquired diseases controlled by genes located at the 13 chromosome 13q14 region.

  • Lee EY, et al. (1986) Molecular cloning of the human esterase D gene, a genetic marker of retinoblastoma. Proc Natl Acad Sci. 83(17):6337-41.
  • Lee EY, et al. (1988) Human esterase D gene: complete cDNA sequence, genomic structure, and application in the genetic diagnosis of human retinoblastoma. Hum Genet. 79(2): 137-41.
  • Saito S, et al. (2003) Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet. 48(5): 249-70.
  • Size / Price
    Catálogo: HG14252-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.