After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ESD Información de producto de clon de cDNA
Gene_bank_ref_id:BC001169
Tamaño de cDNA:849bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens esterase D with N terminal His tag.
Sinónimo de gen:RP11-147L20.1, FGH, FLJ11763, ESD
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14252-ACG$225
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14252-ACR$225
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14252-ANG$225
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14252-ANR$225
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14252-CF$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14252-CH$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14252-CM$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14252-CY$195
Humano Esterase D/ESD clonación del ADN o clonación génica(Vector de expresión)HG14252-G$75
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14252-NF$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14252-NH$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14252-NM$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14252-NY$195
Humano Esterase D/ESD clonación del ADN o clonación génica(vector de clonación)HG14252-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase D is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. Esterase D gene is used as a genetic marker and a diagnostic tool for retinoblastoma, Wilson's disease and other hereditary or acquired diseases controlled by genes located at the 13 chromosome 13q14 region.

Referencias
  • Lee EY, et al. (1986) Molecular cloning of the human esterase D gene, a genetic marker of retinoblastoma. Proc Natl Acad Sci. 83(17):6337-41.
  • Lee EY, et al. (1988) Human esterase D gene: complete cDNA sequence, genomic structure, and application in the genetic diagnosis of human retinoblastoma. Hum Genet. 79(2): 137-41.
  • Saito S, et al. (2003) Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet. 48(5): 249-70.
  • Size / Price
    Catálogo: HG14252-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"