Pedido rápido

Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Humano EZH2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_004456.3
Tamaño de cDNA:2256bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens enhancer of zeste homolog 2 (Drosophila).
Sinónimo de gen:ENX1, EZH1, KMT6, ENX-1, KMT6A, MGC9169, EZH2
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-EZH2
Sitio de restricción:KpnI + NotI (6.1kb + 2.26kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with EZH2 qPCR primers for gene expression analysis, HP101222 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11337-ACG$245
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11337-ACR$245
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11337-ANG$245
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11337-ANR$245
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11337-CF$215
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11337-CH$215
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11337-CM$215
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11337-CY$215
Humano EZH2/KMT6 clonación del ADN o clonación génica(Vector de expresión)HG11337-M$75
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11337-NF$215
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11337-NH$215
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11337-NM$215
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11337-NY$215
Humano EZH2/KMT6 clonación del ADN o clonación génica(vector de clonación)HG11337-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11337-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"