After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human F7 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000131.3
Tamaño de cDNA:1335bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens coagulation factor VII (serum prothrombin conversion accelerator) transcript variant 1 with C terminal Myc tag.
Sinónimo de gen:SPCA
Especie:Human
Vector:pCMV3-C-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14137-ACG$225
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14137-ACR$225
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14137-CF$195
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14137-CH$195
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14137-CM$195
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14137-CY$195
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG14137-G$75
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14137-NF$195
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14137-NH$195
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14137-NM$195
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14137-NY$195
Humano Coagulation Factor VII transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG14137-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Coagulation factor VII, also known as Serum prothrombin conversion accelerator, Factor VII, F7 and FVII, is a member of the peptidase S1 family. Factor VII is one of the central proteins in the coagulation cascade. It is an enzyme of the serine protease class, and Factor VII (FVII) deficiency is the most frequent among rare congenital bleeding disorders. Factor VII contains two EGF-like domains, one Gla (gamma-carboxy-glutamate) domain and one peptidase S1 domain. The main role of factor VII is to initiate the process of coagulation in conjunction with tissue factor (TF). Tissue factor is found on the outside of blood vessels, normally not exposed to the blood stream. The action of the Factor VII is impeded by tissue factor pathway inhibitor (TFPI), which is released almost immediately after initiation of coagulation. Factor VII is vitamin K dependent and is produced in the liver. Upon vessel injury, tissue factor is exposed to the blood and circulating Factor VII. Once bound to TF, FVII is activated to FVIIa by different proteases, among which are thrombin (factor IIa), factor Xa, IXa, XIIa, and the FVIIa-TF complex itself. Recombinant activated factor VII (rFVIIa) is a haemostatic agent, which was originally developed for the treatment of haemophilia patients with inhibitors against factor FVIII or FIX. FVIIa binds specifically to endothelial protein C receptor (EPCR), a known cellular receptor for protein C and activated protein C, on the endothelium. rFVIIa is a novel hemostatic agent, originally developed for the treatment of hemorrhage in hemophiliacs with inhibitors, which has been successfully used recently in an increasing number of nonhemophilic bleeding conditions.

Referencias
  • Franchini M, et al. (2007) Potential role of recombinant activated factor VII for the treatment of severe bleeding associated with disseminated intravascular coagulation: a systematic review. Blood Coagul Fibrinolysis. 18(7): 589-93.
  • Lapecorella M, et al. (2008) Factor VII deficiency: defining the clinical picture and optimizing therapeutic options. Haemophilia. 14(6): 1170-5.
  • Grottke O, et al. (2010) Activated recombinant factor VII (rFVIIa). Best Pract Res Clin Anaesthesiol. 24(1): 95-106.
  • Size / Price
    Catálogo: HG14137-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"