After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano FAM19A1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human FAM19A1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_213609.2
Tamaño de cDNA:402bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens family with sequence similarity 19 (chemokine (C-C motif)-like), member A1.
Sinónimo de gen:TAFA1, TAFA-1, FAM19A1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FAM19A1
Sitio de restricción:KpnI + XbaI (6.1kb + 0.4kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human FAM19A1 Gene Plasmid Map
Human FAM19A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano FAM19A1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"