Pedido rápido

Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human FAP Información de producto de clon de cDNA
Gene_bank_ref_id:NM_004460.2
Tamaño de cDNA:2283bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens fibroblast activation protein, alpha with C terminal His tag.
Sinónimo de gen:FAPA, DPPIV, DKFZp686G13158, FAP
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10464-ACG$245
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10464-ACR$245
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10464-CF$215
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10464-CH$215
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10464-CM$215
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10464-CY$215
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(Vector de expresión)HG10464-M$75
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10464-M-H$215
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10464-NF$215
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10464-NH$215
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10464-NM$215
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10464-NY$215
Humano Fibroblast Activation Proteína alpha/FAP clonación del ADN o clonación génica(vector de clonación)HG10464-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Seprase, also known as 170 kDa melanoma membrane-bound gelatinase , Fibroblast activation protein alpha, Integral membrane serine protease and FAP, is a single-pass type II membrane protein which belongs to the peptidase S9B family. Seprase / FAP is found in cell surface lamellipodia, invadopodia and on shed vesicles. Seprase / FAP appears to act as a proteolytically active 170-kDa dimer, consisting of two 97-kDa subunits. It is a member of the group type II integral serine proteases, which includes dipeptidyl peptidase IV ( DPPIV / CD26 ) and related type II transmembrane prolyl serine peptidases, which exert their mechanisms of action on the cell surface. Seprase / FAP colocalized with DPP4 in invadopodia and lamellipodia of migratory activated endothelial cells in collagenous matrix. Seprase / FAP colocalized with DPP4 on endothelial cells of capillary-like microvessels but not large vessels within invasive breast ductal carcinoma. DPP4 and seprase exhibit multiple functions due to their abilities to form complexes with each other and to interact with other membrane-associated molecules. In association with DPP4, Seprase / FAP is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. Seprase / FAP has a dual function in tumour progression. The proteolytic activity of Seprase has been shown to promote cell invasiveness towards the ECM and also to support tumour growth and proliferation. Seprase / FAP may have a role in tissue remodeling during development and wound healing, and may contribute to invasiveness in malignant cancers.

Referencias
  • Mori,Y. et al., 2004, Oncology. 67 (5-6):411-9.
  • Aertgeerts K., et al., 2005, J. Biol. Chem. 280:19441-19444.
  • Liu T., et al., 2005, J. Proteome Res. 4:2070-2080.
  • Ghersi G., et al., 2006, Cancer Res. 66:4652-4661.
  • O'Brien,P. et al., 2008, Biochim Biophys Acta. 1784 (9):1130-45.
  • Size / Price
    Catálogo: HG10464-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"