After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano FEM1B clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human FEM1B Información de producto de clon de cDNA
Gene_bank_ref_id:NM_015322.3
Tamaño de cDNA:1884bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens fem-1 homolog b (C. elegans).
Sinónimo de gen:FIAA, DKFZp451E0710, FEM1B
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-FEM1B
Sitio de restricción:KpnI + XbaI (6.1kb + 1.88kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations 1479 T/C and 1686 C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human FEM1B Gene Plasmid Map
Human FEM1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano FEM1B clonación del ADN o clonación génica(vector de clonación) on other vectors
Product nameProduct name
Size / Price
Catálogo: HG11180-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human FEM1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"