After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human FGFR1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_023106.2
Tamaño de cDNA:2196bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens fibroblast growth factor receptor 1 with C terminal Myc tag.
Sinónimo de gen:CEK, FLG, FLT2, KAL2, BFGFR, CD331, FGFBR, HBGFR, N-SAM, FLJ99988
Especie:Human
Vector:pCMV3-C-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10616-ACG$245
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10616-ACR$245
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10616-CF$215
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10616-CH$215
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10616-CM$215
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10616-CY$215
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(Vector de expresión)HG10616-M$75
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10616-NF$215
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10616-NH$215
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10616-NM$215
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10616-NY$215
Humano FGFR1/CD331 transcript variant 4 clonación del ADN o clonación génica(vector de clonación)HG10616-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. Fibroblast growth factors (FGFs) (FGF1 - 10 and 16 - 23) are mitogenic signaling molecules that have roles in angiogenesis, wound healing, cell migration, neural outgrowth and embryonic development. FGFs bind heparan sulfate glycosaminoglycans, which facilitates dimerization (activation) of FGF receptors. FGFR1 is a full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR1 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. CD331 can be detected in astrocytoma, neuroblastoma and adrenal cortex cell lines. Some isoforms are detected in foreskin fibroblast cell lines, however isoform 17, isoform 18 and isoform 19 are not detected in these cells. Defects in FGFR1 are a cause of Pfeiffer syndrome ,idiopathic hypogonadotropic hypogonadism, Kallmann syndrome type 2, osteoglophonic dysplasia and trigonocephaly non-syndromic.

Referencias
  • Schlessinger J, et al. (2000) Crystal structure of a ternary FGF-FGFR-heparin complex reveals a dual role for heparin in FGFR binding and dimerization. Mol Cell. 6(3):743-50.
  • Dodé C, et al. (2007) Novel FGFR1 sequence variants in Kallmann syndrome, and genetic evidence that the FGFR1c isoform is required in olfactory bulb and palate morphogenesis. Hum Mutat. 28(1): 97-8.
  • Kim HG, et al. (2005) Hypogonadotropic hypogonadism and cleft lip and palate caused by a balanced translocation producing haploinsufficiency for FGFR1. J Med Genet. 42(8):666-72.
  • Size / Price
    Catálogo: HG10616-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"