Pedido rápido

Text Size:AAA

Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human FGG Información de producto de clon de cDNA
Tamaño de cDNA:1314bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens fibrinogen gamma chain with C terminal His tag.
Sinónimo de gen:FGG
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12039-ACG$225
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12039-ACR$225
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12039-CF$195
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12039-CH$195
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12039-CM$195
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12039-CY$195
Human FGG Gene cDNA clone plasmidHG12039-G$125
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12039-NF$195
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12039-NH$195
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12039-NM$195
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12039-NY$195
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(Vector de expresión)HG12039-U$75
Humano Fibrinogen gamma chain clonación del ADN o clonación génica(vector de clonación)HG12039-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG12039-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.