Pedido rápido

Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human FHIT Información de producto de clon de cDNA
Gene_bank_ref_id:BC032336
Tamaño de cDNA:444bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens fragile histidine triad with C terminal Flag tag.
Sinónimo de gen:FRA3B, AP3Aase
Especie:Human
Vector:pCMV3-C-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14434-ACG$225
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14434-ACR$225
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14434-ANG$225
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14434-ANR$225
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14434-CF$195
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14434-CH$195
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14434-CM$195
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14434-CY$195
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(Vector de expresión)HG14434-G$75
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14434-NF$195
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14434-NH$195
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14434-NM$195
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14434-NY$195
Humano Fragile histidine triad / FHIT clonación del ADN o clonación génica(vector de clonación)HG14434-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Fragile histidine triad, also known as FHIT, may play a key role in differentiating humans from apes. Fragile histidine triad gene belongs to the histidine triad gene family. It has been shown that fragile histidine triad synergizes with VHL, another tumor suppressor, in protecting against chemically - induced lung cancer. Fragile histidine triad gene works as a tumor suppressor as it has been demonstrated in animal studies. The exact molecular function of FHIT is still partially unclear. It also acts as a tumor suppressor of HER2/neu driven breast cancer.

Referencias
  • Lambert N, et al. (2006) An RNA gene expressed during cortical development evolved rapidly in humans. Nature. 443(7108):167-72.
  • Pekarsky Y, et al. (1998) Nitrilase and Fhit homologs are encoded as fusion proteins in Drosophila melanogaster and Caenorhabditis elegans. Proc Natl Acad Sci. 95(15):8744-9.
  • Ohta M, et al. (1996) The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell. 84(4): 587-97.
  • Size / Price
    Catálogo: HG14434-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"