Pedido rápido

Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano FIGNL1 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC051867
    Tamaño de cDNA:2025bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens fidgetin-like 1 DNA.
    Sinónimo de gen:FIGNL1
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FIGNL1 qPCR primers for gene expression analysis, HP103832 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15206-ACG$245
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15206-ACR$245
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15206-ANG$245
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15206-ANR$245
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15206-CF$215
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15206-CH$215
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15206-CM$215
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15206-CY$215
    Humano FIGNL1 clonación del ADN o clonación génica(Vector de expresión)HG15206-G$75
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15206-NF$215
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15206-NH$215
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15206-NM$215
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15206-NY$215
    Humano FIGNL1 clonación del ADN o clonación génica(vector de clonación)HG15206-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG15206-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"