Pedido rápido

Humano FLRT3 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human FLRT3 Información de producto de clon de cDNA
Tamaño de cDNA:1950bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens fibronectin leucine rich transmembrane protein 3 with N terminal HA tag.
Sinónimo de gen:FLRT3
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Leucine-rich repeat transmembrane protein FLRT3, also known as Fibronectin-like domain-containing leucine-rich transmembrane protein 3, and FLRT3, is a single-pass type I membrane protein which belongs to the fibronectin leucine rich transmembrane protein (FLRT) family. FLRT3 contains one fibronectin type-III domain and ten LRR (leucine-rich) repeats and is expressed in kidney, brain, pancreas, skeletal muscle, lung, liver, placenta, and heart. It has a provocative expression pattern during somite development being expressed in regions of the somite where muscle precursor cells migrate from the dermomyotome and move into the myotome, and later in myotomal precursors destined to migrate towards their final destination. FLRT1, FLRT2 and FLRT3 are members of the FLRT family. The FLRT family of leucine-rich repeat (LRR) proteins is implicated in fibroblast growth factor (FGF) signalling, early embryonic development and neurite outgrowth. FLRT3 shares 55% amino acid sequence identity with FLRT1 and 44% identity with FLRT2. Two alternatively spliced transcript variants encoding the same protein have been described. The expression of FLRT3 is controlled by fibroblast growth factors (FGFs). FLRT3 has been implicated in neurite outgrowth after nerve damage, as a positive regulator of FGF signalling and in homotypic cell adhesion. FLRT3 may have a crucial role in regulating cellular adhesion between the epithelial apical ridge and the underlying mesenchyme and in establishing the dorso-ventral position of the ridge.

  • Smith TG, et al. (2006) The expression of Flrt3 during chick limb development. Int J Dev Biol. 50(8): 701-4.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Karaulanov EE, et al. (2006) A role for fibronectin-leucine-rich transmembrane cell-surface proteins in homotypic cell adhesion. EMBO Rep. 7(3): 283-90.
  • Gong SG, et al. (2009) Flrt2 and Flrt3 have overlapping and non-overlapping expression during craniofacial development. Gene Expr Patterns. 29(7): 497-502.
  • Size / Price
    Catálogo: HG11166-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.