Pedido rápido

Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano FOXRED2 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC040351
    Tamaño de cDNA:2055bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens FAD-dependent oxidoreductase domain containing 2.
    Sinónimo de gen:ERFAD, FOXRED2
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FOXRED2 qPCR primers for gene expression analysis, HP101998 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13290-ACG$245
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13290-ACR$245
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG13290-ANG$245
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG13290-ANR$245
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13290-CF$215
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13290-CH$215
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13290-CM$215
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13290-CY$215
    Humano FOXRED2 clonación del ADN o clonación génica(Vector de expresión)HG13290-G$75
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13290-NF$215
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13290-NH$215
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13290-NM$215
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13290-NY$215
    Humano FOXRED2 clonación del ADN o clonación génica(vector de clonación)HG13290-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG13290-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"