Pedido rápido

Humano GBA/glucocerebrosidase clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Humano GBA Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000157
Tamaño de cDNA:1611bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens glucosidase, beta, acid.
Sinónimo de gen:GBA1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-GBA
Sitio de restricción:NheI + XbaI (6.1kb + 1.61kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with GBA qPCR primers for gene expression analysis, HP101572 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano GBA Gene Plasmid Map
Human GBA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano GBA/glucocerebrosidase clonación del ADN o clonación génica(vector de clonación) on other vectors
Product nameProduct name
Size / Price
Catálogo: HG12038-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
  • Human GBA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"