Pedido rápido

Humano GCSH clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human GCSH Información de producto de clon de cDNA
Tamaño de cDNA:522bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens glycine cleavage system protein H (aminomethyl carrier) with N terminal Flag tag.
Sinónimo de gen:GCE, NKH
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano GCSH clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Product nameProduct name

Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). GCSH is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in GCSH gene are a cause of nonketotic hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other probably not protein-coding,have been found for GCSH gene. Also, several transcribed and non-transcribed pseudogenes of GCSH gene exist throughout the genome.

  • Hiraga K. et al., 1988, Biochem Biophys Res Commun. 151 (2): 758-62.
  • Fujiwara K. et al., 1991, Biochem Biophys Res Commun. 176 (2): 711-6.
  • Koyata H. et al., 1991, Am J Hum Genet. 48 (2): 351-61.
  • Size / Price
    Catálogo: HG14568-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.