Pedido rápido

Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human GFRA1 Información de producto de clon de cDNA
Tamaño de cDNA:1383bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens GDNF family receptor alpha 1, transcript variant 2 with C terminal Flag tag.
Sinónimo de gen:GDNFR, RET1L, RETL1, TRNR1, GDNFRA, MGC23045, GFR-ALPHA-1
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10330-ACG$225
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10330-ACR$225
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10330-CF$195
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10330-CH$195
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10330-CM$195
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10330-CY$195
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)HG10330-M$75
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10330-M-F$195
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10330-NF$195
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10330-NH$195
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10330-NM$195
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10330-NY$195
Humano GFRA1 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG10330-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 1 (GFRA1) is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA1 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. GDNF, a distantly related member of the transforming growth factor-β (TGF-â) superfamily, and its receptor components: GFRA1, Ret and neural cell adhesion molecule (NCAM) have been recently reported to be expressed in the testis and to be involved in the proliferation regulation of immature Sertoli cells.

  • Jing S, et al. (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem. 272(52): 33111-7.
  • Jing S, et al. (1996) GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell. 85(7):1113-24.
  • Treanor JJ, et al. (1996) Characterization of a multicomponent receptor for GDNF. Nature. 382(6586): 80-3.
  • Size / Price
    Catálogo: HG10330-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.