Pedido rápido

Humano alpha-Galactosidase A clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human GLA Información de producto de clon de cDNA
Tamaño de cDNA:1290bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens galactosidase, alpha with N terminal Flag tag.
Sinónimo de gen:GALA
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano alpha-Galactosidase A clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Product nameProduct name

Alpha-galactosidase A, also known as Alpha-D-galactoside galactohydrolase, Alpha-D-galactosidase A, Melibiase and GLA, is a member of the glycosyl hydrolase 27 family. GLA is used as a long-term enzyme replacement therapy in patients with a confirmed diagnosis of Fabry disease. Defects in GLA are the cause of Fabry disease (FD) which is a rare X-linked sphingolipidosis disease where glycolipid accumulates in many tissues. The disease consists of an inborn error of glycosphingolipid catabolism. FD patients show systemic accumulation of globotriaoslyceramide (Gb3) and related glycosphingolipids in the plasma and cellular lysosomes throughout the body. Clinical recognition in males results from characteristic skin lesions (angiokeratomas) over the lower trunk. Patients may show ocular deposits, febrile episodes, and burning pain in the extremities. Death results from renal failure, cardiac or cerebral complications of hypertension or other vascular disease. Deficiency of GLA leads to the accumulation of glycosphingolipids in the vasculature leading to multiorgan pathology. In addition to well-described microvascular disease, deficiency of GLA is also characterized by premature macrovascular events such as stroke and possibly myocardial infarction.

  • Koide al., 1990, FEBS Lett. 259:353-356.
  • Yang C.-C. et al., 2003, Clin. Genet. 63:205-209.
  • Verovnik F. et al.,2004, Eur. J. Hum. Genet. 12:678-681.
  • Nance C.S. et al., 2006, Arch. Neurol. 63:453-457.
  • Size / Price
    Catálogo: HG12078-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.