After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human GOPC Información de producto de clon de cDNA
Gene_bank_ref_id:BC009553
Tamaño de cDNA:1365bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens golgi-associated PDZ and coiled-coil motif containing with N terminal Myc tag.
Sinónimo de gen:CAL, FIG, PIST, GOPC1, dJ94G16.2
Especie:Human
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14911-ACG$225
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14911-ACR$225
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14911-ANG$225
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14911-ANR$225
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14911-CF$195
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14911-CH$195
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14911-CM$195
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14911-CY$195
Humano GOPC / PIST clonación del ADN o clonación génica(Vector de expresión)HG14911-G$75
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14911-NF$195
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14911-NH$195
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14911-NM$195
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14911-NY$195
Humano GOPC / PIST clonación del ADN o clonación génica(vector de clonación)HG14911-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

GOPC, also known as PIST, interacts specifically with TC10 (a Rho-family small GTPase)] as a binding partner for Rhotekin. Rhotekin associates with PIST in vitro and in both polarized and non-polarized MDCK (Madin-Darby canine kidney) cells. The C-terminal SPV (Ser-Pro-Val) motif of Rhotekin binds to the PDZ domain of PIST. The co-localization of PIST and Rhotekin at the Golgi apparatus can be detected in non-polarized fibroblast-like MDCK cells and AJs (adherens junctions) in the fully polarized cells. PIST and Rhotekin are recruited from the cytosol to AJs as the cell becomes polarized. Expression of constitutively active Rho or prevention of Rhotekin-PIST interaction induced diffuse cytoplasmic distribution of Rhotekin in polarized MDCK cells. GOPC may regulate CFTR chloride currents and acid-induced ACCN3 currents by modulating cell surface expression of both channels. It may also regulate the intracellular trafficking of the ADR1B receptor. GOPC is ubiquitously expressed and its overexpression results in CFTR intracellular retention and degradation in the lysosomes.

Referencias
  • Hicks SW. et al., 2005, J Biol Chem. 280 (32): 28944-51.
  • Ito H. et al., 2006, Biochem J Aug. 397 (3): 389-98.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"