Pedido rápido

Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano GOT1 Información de producto de clon de cDNA
    Tamaño de cDNA:1242bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) with N terminal HA tag.
    Sinónimo de gen:ASTQTL1, GIG18, GOT1
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    ( We provide with GOT1 qPCR primers for gene expression analysis, HP102847 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14196-ACG$225
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14196-ACR$225
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG14196-ANG$225
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG14196-ANR$225
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14196-CF$195
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14196-CH$195
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14196-CM$195
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14196-CY$195
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(Vector de expresión)HG14196-G$75
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14196-NF$195
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14196-NH$195
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14196-NM$195
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14196-NY$195
    Humano Aspartate aminotransferase / GOT1 clonación del ADN o clonación génica(vector de clonación)HG14196-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name

    Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Catálogo: HG14196-NY
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.