Pedido rápido

Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano GSTM2 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_000848
    Tamaño de cDNA:657bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens glutathione S-transferase mu 2 (muscle), transcript variant 1 with C terminal His tag.
    Sinónimo de gen:GST4
    Especie:Human
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GSTM2 qPCR primers for gene expression analysis, HP101576 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12042-ACG$225
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12042-ACR$225
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12042-ANG$225
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12042-ANR$225
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12042-CF$195
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12042-CH$195
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12042-CM$195
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12042-CY$195
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG12042-G$75
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12042-NF$195
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12042-NH$195
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12042-NM$195
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12042-NY$195
    Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG12042-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Glutathione S-transferase Mu 2, also known as GST class-mu 2, GSTM2-2 and GSTM2, is a cytoplasm protein which belongs to the GST superfamily and Mu family. GSTM2 / GST4 contains one GST C-terminal domain and one GST N-terminal domain. The glutathione S-transferases (GSTs) are a multigene family of enzymes largely involved in the detoxification of chemicals. Eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. Butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2. Butyrate may act chemoprotectively by increasing detoxification capabilities in the colon mucosa.

    Referencias
  • Campbell E, et al.,1990, J Biol Chem 265 (16): 9188-93. 
  • Vorachek WR, et al.,1991, Proc Natl Acad Sci USA. 88 (10): 4443-7.
  • Ebert,M.N. et al., 2003, Carcinogenesis. 24 (10):1637-44.
  • Size / Price
    Catálogo: HG12042-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"