Pedido rápido

Text Size:AAA

Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human GSTM2 Información de producto de clon de cDNA
Tamaño de cDNA:657bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens glutathione S-transferase mu 2 (muscle), transcript variant 1 with C terminal His tag.
Sinónimo de gen:GST4
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12042-ACG$225
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12042-ACR$225
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12042-ANG$225
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12042-ANR$225
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12042-CF$195
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12042-CH$195
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12042-CM$195
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12042-CY$195
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG12042-G$75
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12042-NF$195
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12042-NH$195
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12042-NM$195
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12042-NY$195
Humano GSTM2 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG12042-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Glutathione S-transferase Mu 2, also known as GST class-mu 2, GSTM2-2 and GSTM2, is a cytoplasm protein which belongs to the GST superfamily and Mu family. GSTM2 / GST4 contains one GST C-terminal domain and one GST N-terminal domain. The glutathione S-transferases (GSTs) are a multigene family of enzymes largely involved in the detoxification of chemicals. Eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. Butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2. Butyrate may act chemoprotectively by increasing detoxification capabilities in the colon mucosa.

  • Campbell E, et al.,1990, J Biol Chem 265 (16): 9188-93. 
  • Vorachek WR, et al.,1991, Proc Natl Acad Sci USA. 88 (10): 4443-7.
  • Ebert,M.N. et al., 2003, Carcinogenesis. 24 (10):1637-44.
  • Size / Price
    Catálogo: HG12042-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.