Pedido rápido

Humano GSTZ1 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano GSTZ1 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC001453
    Tamaño de cDNA:651bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens glutathione S-transferase zeta 1.
    Sinónimo de gen:GSTZ1-1, MAAI, MAI, MGC2029, GSTZ1
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GSTZ1 qPCR primers for gene expression analysis, HP102887 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano GSTZ1 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Product nameProduct name
    Fondo

    GSTZ1 gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. GSTZ1 is a bifunctional protein which has minimal glutathione-conjugating activity with ethacrynic acid and 7-chloro-4-nitrobenz-2-oxa-1,3-diazole and maleylacetoacetate isomerase activity. GSTZ1 catalyzes the glutathione dependent oxygenation of dichloroacetic acid to glyoxylic acid. GSTZ1 participates in the catabolism of phenylalanine and tyrosine. Thus defects in GSTZ1 cause harsh metabolic disorders including alkaptonuria, phenylketonuria and tyrosinaemia.

    Referencias
  • Tong Z. et al., 1999, Chem Res Toxicol. 11 (11): 1332-8.
  • Tong Z. et al., 1999, Biochem J. 331 (2): 371-4.
  • Ketterer B. 2001, Chem Biol Interact. 138 (1): 27-42.
  • Size / Price
    Catálogo: HG14237-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"