Pedido rápido

Humano GCAP1 / GUCA1A clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human GUCA1A Información de producto de clon de cDNA
Tamaño de cDNA:606bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens guanylate cyclase activator 1A (retina) with N terminal Flag tag.
Sinónimo de gen:COD3, GCAP, GUCA, GCAP1, GUCA1, CORD14, C6orf131, dJ139D8.6
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano GCAP1 / GUCA1A clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Product nameProduct name

GCAP 1 gene plays a role in the recovery of retinal photoreceptors from photobleaching. In the recovery phase, the phototransduction messeneger cGMP is replenished by retinal guanylyl cyclase-1 (GC1). GC1 is activated by decreasing Ca(2+) concentrations following photobleaching. The protein encoded by this gene, guanylyl cyclase activating protein 1 (GCAP 1), mediates the sensitivity of GC1 to Ca(2+) concentrations. GCAP 1 promotes activity of GC1 at low Ca(2+) concentrations and inhibits GC1 activity at high Ca(2+) concentrations. Mutations in GCAP 1 gene cause autosomal dominant cone dystrophy (COD3); a disease characterized by reduced visual acuity associated with progressive loss of color vision. GCAP 1 stimulates guanylyl cyclase 1 (GC1) when free calcium ions concentration is low and inhibits GC1 when free calcium ions concentration is elevated. This Ca(2+)-sensitive regulation of GC is a key event in recovery of the dark state of rod photoreceptors following light exposure.

  • Surguchov A, et al. (1997) The human GCAP1 and GCAP2 genes are arranged in a tail-to-tail array on the short arm of chromosome 6 (p21.1). Genomics. 39(3):312-22.
  • Subbaraya I, et al. (1995) Molecular characterization of human and mouse photoreceptor guanylate cyclase-activating protein (GCAP) and chromosomal localization of the human gene. J Biol Chem. 269(49):31080-9.
  • Payne AM, et al. (1998) A mutation in guanylate cyclase activator 1A (GCAP 1) in an autosomal dominant cone dystrophy pedigree mapping to a new locus on chromosome 6p21.1. Hum Mol Genet. 7(2):273-7.
  • Size / Price
    Catálogo: HG14565-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.