Pedido rápido

Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano GZMH Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_033423.3
    Tamaño de cDNA:741bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens granzyme H (cathepsin G-like 2, protein h-CCPX) with C terminal Flag tag.
    Sinónimo de gen:CCP-X, CGL-2, CSP-C, CTLA1, CTSGL2
    Especie:Human
    Vector:pCMV3-C-FLAG
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GZMH qPCR primers for gene expression analysis, HP100089 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10348-ACG$225
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10348-ACR$225
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10348-CF$195
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10348-CH$195
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10348-CM$195
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10348-CY$195
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(Vector de expresión)HG10348-M$75
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10348-M-F$195
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10348-NF$195
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10348-NH$195
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10348-NM$195
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10348-NY$195
    Humano Granzyme H/GZMH clonación del ADN o clonación génica(vector de clonación)HG10348-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Granzymes are key components of the immune response that play important roles in eliminating host cells infected by intracellular pathogens. Several granzymes are potent inducers of cell death. A total of eight granzymes (A-G and M) have been identified in the mouse, but only five are known in humans (A, B, H, M and granzyme 3), and granzyme H appears to be specifically human. Human granzyme H is a neutral serine protease that is expressed predominantly in the lymphokine-activated killer (LAK)/natural?killer (NK) compartment of the immune system. In adenovirus-infected cells in which granzyme B (gzmB) and downstream apoptosis pathways are inhibited, granzyme H directly cleaves the adenovirus DNA-binding protein (DBP), a viral component absolutely required for viral DNA replication. This virus demonstrated that gzmH directly induces an important decay in viral DNA replication. Interestingly, gzmH also cleaves the adenovirus 100K assembly protein, a major inhibitor of gzmB, and relieves gzmB inhibition. Granzyme H has a very high amino acid identity (>90%) with many portions of the granzyme B sequence, particularly near the amino terminus of the molecule despite performing a distinct enzymic function.

    Size / Price
    Catálogo: HG10348-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"