Pedido rápido

Humano HAO1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human HAO1 Información de producto de clon de cDNA
Tamaño de cDNA:1113bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens hydroxyacid oxidase (glycolate oxidase) 1 with N terminal Flag tag.
Sinónimo de gen:GOX, GOX1, HAOX1, MGC142225, MGC142227, HAO1
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano HAO1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Product nameProduct name

Hydroxyacid oxidase 1, also known as Glycolate oxidase, HAO1 and GOX1, is a member of the FMN-dependent alpha-hydroxy acid dehydrogenase family. HAO1 / GOX1 has 2-hydroxyacid oxidase activity. It is most active on the 2-carbon substrate glycolate, but is also active on 2-hydroxy fatty acids, with high activity towards 2-hydroxy palmitate and 2-hydroxy octanoate. HAO1 / GOX1 is a liver-specific peroxisomal enzyme that oxidizes glycolate to glyoxylate with concomitant production of H2O2. In Hao1 messenger RNA (mRNA), an iron-responsive element (IRE) homologous to the sequence recognized by iron regulatory proteins (IRP), key regulators of iron homeostasis, is present. Mammalian HAO1 / GOX1 is a peroxisomal protein and that the C-terminal sequence SKI acts as the targeting signal. Down-regulation of HAO1 / GOX1 expression during oxidative stress may provide a mechanism to prevent excessive H2O2 formation in liver peroxisomes and may represent the prototype of a poorly recognized but potentially relevant response to oxidative injury involving down-regulation of ROS-producing enzymes.

  • Jones al., 2000, J. Biol. Chem. 275:12590-7.
  • Recalcati,S. et al., 2001, J Cell Sci. 114 (Pt 9):1625-9.
  • Recalcati,S. et al., 2003, Hepatology. 38 (5):1159-66.
  • Murray al., 2008, Biochemistry 47:2439-49.
  • Bourhis al., 2009, Acta Crystallogr. F 65:1246-53.
  • Size / Price
    Catálogo: HG12076-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.