After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human HBB Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000518
Tamaño de cDNA:444bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens hemoglobin, beta.
Sinónimo de gen:CD113t-C, HBD, beta-globin
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HBB
Sitio de restricción:KpnI + XbaI (6.1kb + 0.44kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human HBB Gene Plasmid Map
Human HBB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12016-ACG$225
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12016-ACR$225
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12016-ANG$225
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12016-ANR$225
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12016-CF$195
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12016-CH$195
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12016-CM$195
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12016-CY$195
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(Vector de expresión)HG12016-G$75
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12016-NF$195
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12016-NH$195
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12016-NM$195
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12016-NY$195
Humano HBB/hemoglobin-beta clonación del ADN o clonación génica(vector de clonación)HG12016-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG12016-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human HBB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"